Summary for the 336-th Site(A) |
PID | QueryLength | FocusSite | TITLE |
8219 | 601 | 336 A |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
A:30% Y:16% N:14% Q:14% E:13% S:13% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
6xez | S (bend) | e (exposed) | 66.1 |
Predicted Bind Molecules |
nucleotide:3 |
Templates for 3D complexes |
nucleotide [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_E_1_T_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |