#WARNING:no index is registered index "YP_009725308.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725308.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 68-th Site(M)

PID QueryLength FocusSite TITLE
8219 601 68 M
UniProt Information
AC/IDAC:YP_009725308.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
M:65% L:35% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7cxm S (bend) e (exposed) 81.6
3D Complex Information
Predicted Bind Molecules
hetero:19 nucleotide:6 compound:1
Templates for 3D complexes
hetero [28567:R1AB_SARS2 ] 6xez_E_1_D_1 7cxm_H_1_B_1 7cxn_I_1_D_1 7cyq_G_1_D_1 7eiz_J_1_B_1 7eiz_K_1_D_1 7krn_E_1_D_1 7kro_E_1_D_1 7kro_F_1_B_1 8gw1_H_1_B_1 8gwb_E_1_D_1 8gwe_E_1_B_1 8gwf_H_1_B_1 8gwg_H_1_B_1 8gwi_H_1_B_1 8gwk_G_1_D_1 8gwn_G_1_D_1 8gwn_H_1_B_1 8gwo_G_1_D_1 nucleotide [agcugcucccuagcaugcuacuaccg ] 8gw1_G_1_F_1 [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_E_1_J_1 8gwf_G_1_F_1 8gwg_G_1_F_1 8gwi_G_1_F_1 [ugacugcucccuagcaugcuacuaccg ] 8gwe_F_1_J_1 compound [1N7 ] 7krn_E_1_T_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]