Summary for the 535-th Site(S) |
PID | QueryLength | FocusSite | TITLE |
8219 | 601 | 535 S |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
S:59% G:31% Q:11% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7cxm | G (3/10-helix) | e (exposed) | 50.8 |
Predicted Bind Molecules |
nucleotide:1 |
Templates for 3D complexes |
nucleotide [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7kro_E_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |