Summary for the 233-rd Site(M) |
PID | QueryLength | FocusSite | TITLE |
8219 | 601 | 233 M |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
A:34% Q:28% S:14% M:13% V:11% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7cxm | (coil) | e (exposed) | 51.7 |
Predicted Bind Molecules |
nucleotide:4 compound:1 |
Templates for 3D complexes |
nucleotide [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxxxxaugugauuuuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdx_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [6SU ] 5rmc_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |