Summary for the 146-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
8219 | 601 | 146 K |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7cxm | H (alpha-helix) | b (buried) | 15.1 |
Predicted Bind Molecules |
nucleotide:3 compound:2 |
Templates for 3D complexes |
nucleotide [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [LJA ] 5rl6_B_1_H_1 [VXD ] 5rml_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |