#WARNING:no index is registered index "YP_009725308.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725308.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 77-th Site(P)

PID QueryLength FocusSite TITLE
8219 601 77 P
UniProt Information
AC/IDAC:YP_009725308.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
P:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
6xez (coil) e (exposed) 31.0
3D Complex Information
Predicted Bind Molecules
nucleotide:1 compound:1
Templates for 3D complexes
nucleotide [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_E_1_J_1 compound [UVJ ] 5rlt_B_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]