Summary for the 68-th Site(M) |
PID | QueryLength | FocusSite | TITLE |
8219 | 601 | 68 M |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
M:65% L:35% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
6xez | S (bend) | e (exposed) | 75.4 |
Predicted Bind Molecules |
hetero:27 nucleotide:3 compound:4 |
Templates for 3D complexes |
hetero [28576:R1AB_SARS2 ] 6xez_E_1_D_1 7cxm_H_1_B_1 7cxn_I_1_D_1 7cyq_G_1_D_1 7egq_Q_1_B_1 7eiz_J_1_B_1 7eiz_K_1_D_1 7krn_E_1_D_1 7kro_E_1_D_1 7kro_F_1_B_1 7rdx_E_1_D_1 7rdx_F_1_B_1 7rdy_E_1_D_1 7rdy_F_1_B_1 7re0_E_1_D_1 7re0_F_1_B_1 7re1_E_1_D_1 7re1_F_1_B_1 7re2_E_1_D_1 8gw1_H_1_B_1 8gwb_E_1_D_1 8gwe_E_1_B_1 8gwk_G_1_D_1 8gwn_G_1_D_1 8gwn_H_1_B_1 8gwo_G_1_D_1 [92365:R1AB_SARS2 ] 7egq_E_1_P_1 nucleotide [agcugcucccuagcaugcuacuaccg ] 8gw1_G_1_F_1 [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_E_1_J_1 [ugacugcucccuagcaugcuacuaccg ] 8gwe_F_1_J_1 compound [1N7 ] 7krn_E_1_T_1 7rdx_E_1_U_1 7rdy_E_1_O_1 7re1_E_1_U_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |