Summary for the 77-th Site(P) |
PID | QueryLength | FocusSite | TITLE |
8219 | 601 | 77 P |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
P:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | (coil) | e (exposed) | 27.9 |
Predicted Bind Molecules |
nucleotide:1 compound:1 |
Templates for 3D complexes |
nucleotide [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_E_1_J_1 compound [UVJ ] 5rlt_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |