Summary for the 378-th Site(M) |
PID | QueryLength | FocusSite | TITLE |
8219 | 601 | 378 M |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
M:32% Q:30% L:29% A:1% R:1% N:1% D:1% E:1% G:1% I:1% K:1% P:1% S:1% T:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | T (Hbond turn) | e (exposed) | 26.6 |
Predicted Bind Molecules |
nucleotide:3 |
Templates for 3D complexes |
nucleotide [uaaaau ] 7cxm_I_1_G_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |