Summary for the 362-nd Site(A) |
PID | QueryLength | FocusSite | TITLE |
8219 | 601 | 362 A |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
A:51% T:26% H:12% G:11% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | G (3/10-helix) | b (buried) | 17.0 |
Predicted Bind Molecules |
nucleotide:5 compound:2 |
Templates for 3D complexes |
nucleotide [uaaaau ] 7cxm_I_1_G_1 7cxn_I_1_G_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [VVG ] 5rl8_A_1_C_1 [NYV ] 5rlk_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |