|
PID | QueryLength | FocusSite | TITLE |
8219 | 601 | 139 K |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
K:79% R:21% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
H (alpha-helix) | e (exposed) | 31.6 |
Predicted Bind Molecules |
nucleotide:2 |
Templates for 3D complexes |
nucleotide [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |