Summary for the 516-th Site(N) |
PID | QueryLength | FocusSite | TITLE |
8219 | 601 | 516 N |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
N:64% R:21% K:15% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
6xez | H (alpha-helix) | e (exposed) | 40.6 |
Predicted Bind Molecules |
nucleotide:3 compound:2 precipitant:1 |
Templates for 3D complexes |
nucleotide [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [VWM ] 5rlz_A_1_C_1 [VXG ] 5rmm_B_1_H_1 precipitant [SO4 ] 5wwp_B_1_K_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |