Summary for the 340-th Site(V) |
PID | QueryLength | FocusSite | TITLE |
8219 | 601 | 340 V |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
V:50% T:16% N:13% F:13% I:7% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
6xez | S (bend) | b (buried) | 12.7 |
Predicted Bind Molecules |
nucleotide:1 |
Templates for 3D complexes |
nucleotide [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_E_1_T_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |