Summary for the 911-st Site(N) |
PID | QueryLength | FocusSite | TITLE |
7876 | 932 | 911 N |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
N:31% D:24% K:9% A:7% Q:7% G:7% H:7% S:6% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | T (Hbond turn) | e (exposed) | 81.2 |
Predicted Bind Molecules |
nucleotide:3 |
Templates for 3D complexes |
nucleotide [xxxxxxxgcacugcguaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7b3c_A_1_E_1 [xxxxxxccccauaacuuaaucucacauagc ] 7ed5_A_1_F_1 [xxxxxxxxxxxxxxxxxucaugcuucgcguggagaaugacguagcaugcuacxxx ] 8sq9_A_1_G_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |