#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 862-nd Site(L)

PID QueryLength FocusSite TITLE
7876 932 862 L
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
L:70% I:30% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe H (alpha-helix) b (buried) 12.4
3D Complex Information
Predicted Bind Molecules
nucleotide:20 compound:1
Templates for 3D complexes
nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] 6xez_A_1_G_1 [xxgggccca ] 6xqb_A_1_E_1 [xxxxxxxxxxxxxxxuuaaguuau ] 7aap_A_1_E_1 [xxxxxcuacgcgXugxxxx ] 7b3b_A_1_D_1 [xxxxxxxxxgauuaaguuau ] 7bv2_A_1_D_1 [xxxxxxacgacacaggXgxxxx ] 7c2k_A_1_F_1 [xxxxxxxxgcgguaguagcaugcuagggagcag ] 7cyq_A_1_E_1 [gcuaugugagauuaaguuau ] 7ed5_A_1_E_1 [gcgguaguagcaugcuagggagcag ] 7eiz_A_1_G_1 8gwb_A_1_I_1 8gwk_A_1_E_1 [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 [xgcguagcaugcuacgucauucuccuaagaagcug ] 7uo4_A_1_E_1 [xxxguagcaugcuacgucauucuccuaagaagcug ] 7uo7_A_1_D_1 [xxxguagcaugcuacgucauucuccacgcgaagcXxxxx ] 7uo9_A_1_D_1 [xxcguagcaugcuacgucauucuccacgcgaagca ] 7uob_A_1_E_1 7uoe_A_1_E_1 [xxxguagcaugcuacgucauucuccacgcgaagca ] 8sq9_A_1_F_1 compound [H3U ] 7d4f_D_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]