Summary for the 855-th Site(M) |
PID | QueryLength | FocusSite | TITLE |
7876 | 932 | 855 M |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
M:61% L:32% V:6% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | (coil) | e (exposed) | 29.0 |
Predicted Bind Molecules |
nucleotide:13 |
Templates for 3D complexes |
nucleotide [gcgguaguagcaugcuagggagcag ] 7cxm_A_1_E_1 8gw1_A_1_E_1 8gwb_A_1_I_1 8gwe_A_1_I_1 8gwf_A_1_E_1 8gwg_A_1_E_1 8gwi_A_1_E_1 8gwn_A_1_E_1 8gwo_A_1_E_1 [xxxxxxxxgcgguaguagcaugcuagggagcag ] 7cyq_A_1_E_1 [xgcguagcaugcuacgucauucuccuaagaagcug ] 7uo4_A_1_E_1 [xxxguagcaugcuacgucauucuccuaagaagcug ] 7uo7_A_1_D_1 [xxcguagcaugcuacgucauucuccacgcgaagca ] 7uoe_A_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |