#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 760-th Site(D)

PID QueryLength FocusSite TITLE
7876 932 760 D
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
D:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe T (Hbond turn) e (exposed) 38.3
3D Complex Information
Predicted Bind Molecules
nucleotide:35 compound:14 metal:12
Templates for 3D complexes
nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] 6xez_A_1_G_1 [xxgggccca ] 6xqb_A_1_E_1 [xxxxxxxxxxxxxxxuuaaguuau ] 7aap_A_1_E_1 [xxxxxcuacgcgXugxxxx ] 7b3b_A_1_D_1 [xxxxccuacgcXgugxxxx ] 7b3c_A_1_D_1 [xxxxxcuacgcagug ] 7b3d_A_1_D_1 7oyg_A_1_D_1 7oyg_F_1_I_1 [xxxxxxxxxgauuaaguuau ] 7bv2_A_1_D_1 [xxxxxgacgacaca ] 7bzf_A_1_F_1 [xxxxxxacgacacaggXgxxxx ] 7c2k_A_1_F_1 [gcgguaguagcaugcuagggagcag ] 7cxm_A_1_E_1 7cxn_A_1_E_1 8gw1_A_1_E_1 8gwe_A_1_I_1 8gwf_A_1_E_1 8gwg_A_1_E_1 8gwi_A_1_E_1 8gwk_A_1_E_1 8gwm_A_1_H_1 8gwn_A_1_E_1 8gwo_A_1_E_1 [xxxxxxxxgcgguaguagcaugcuagggagcag ] 7cyq_A_1_E_1 [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 [cuaagaagcuauuXXXXxxxxxxxxxxxxxxxx ] 7l1f_A_1_D_1 [xxxxxxxxxxxxxxxxxxxxxxcuacgcagua ] 7ozu_A_1_D_1 [xxxxxxxxxxxxxxxxxxxxxxcuacgcagug ] 7ozv_A_1_D_1 [xgcguagcaugcuacgucauucuccuaagaagcug ] 7uo4_A_1_E_1 [xxxguagcaugcuacgucauucuccuaagaagcug ] 7uo7_A_1_D_1 [xxxguagcaugcuacgucauucuccacgcgaagcXxxxx ] 7uo9_A_1_D_1 [xxxguagcaugcuacgucauucuccacgcgaagca ] 8sq9_A_1_F_1 [xxxxxagcaugcuacgucauucuccacgcgaagcaug ] 8sqj_A_1_F_1 [agcaugcuacgucauucuccacgcgaagcaug ] 8sqk_A_1_F_1 compound [GE6 ] 7aap_A_1_M_1 [F86 ] 7bv2_A_1_K_1 [AT9 ] 7ed5_A_1_K_1 7ed5_A_1_N_1 [NWX ] 7uo4_A_1_G_1 [ATP ] 7uo7_A_1_G_1 [UTP ] 7uo9_A_1_J_1 [GTP ] 7uob_A_1_L_1 [L2B ] 7uob_A_1_N_1 7uoe_A_1_L_1 [CTP ] 7uoe_A_1_K_1 [WSB ] 8sq9_A_1_L_1 [VSN ] 8sqj_A_1_I_1 8sqk_A_1_I_1 metal [MG ] 7aap_A_1_I_1 7bv2_A_1_I_1 7ed5_A_1_L_1 7uo4_A_1_H_1 7uo7_A_1_H_1 7uo9_A_1_I_1 7uob_A_1_I_1 7uob_A_1_J_1 7uoe_A_1_I_1 7uoe_A_1_J_1 8sq9_A_1_J_1 8sq9_A_1_K_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]