Summary for the 593-rd Site(K) |
PID | QueryLength | FocusSite | TITLE |
7876 | 932 | 593 K |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | S (bend) | e (exposed) | 23.1 |
Predicted Bind Molecules |
nucleotide:4 compound:1 |
Templates for 3D complexes |
nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] 7rdz_A_1_G_1 7re2_A_1_F_1 [gcgguaguagcaugcuagggagcag ] 8gw1_A_1_E_1 8gwb_A_1_I_1 compound [GO3 ] 8gy6_A_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |