Summary for the 499-th Site(D) |
PID | QueryLength | FocusSite | TITLE |
7876 | 932 | 499 D |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
D:42% N:25% K:17% P:16% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | (coil) | e (exposed) | 50.6 |
Predicted Bind Molecules |
nucleotide:13 compound:1 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxxuuaaguuau ] 7aap_A_1_E_1 [xxxxccuacgcXgugxxxx ] 7b3c_A_1_D_1 [xxxxxcuacgcagug ] 7b3d_A_1_D_1 7oyg_A_1_D_1 7oyg_F_1_I_1 [xxxxxxxxxgauuaaguuau ] 7bv2_A_1_D_1 [gggagxxxxcuccuccugugucguxxxxx ] 7c2k_A_1_E_1 [xxxxxxacgacacaggXgxxxx ] 7c2k_A_1_F_1 [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 [xxxguagcaugcuacgucauucuccacgcgaagcXxxxx ] 7uo9_A_1_D_1 [xxxguagcaugcuacgucauucuccacgcgaagca ] 8sq9_A_1_F_1 compound [GO3 ] 8gy6_A_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |