Summary for the 931-st Site(L) |
PID | QueryLength | FocusSite | TITLE |
7876 | 932 | 931 L |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
L:81% M:19% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | (coil) | e (exposed) | 116.3 |
Predicted Bind Molecules |
nucleotide:7 |
Templates for 3D complexes |
nucleotide [agcugcucccuagcaugcuacuaccg ] 8gw1_A_1_F_1 8gwk_A_1_F_1 8gwm_A_1_I_1 [ugacugcucccuagcaugcuacuaccg ] 8gwe_A_1_J_1 [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwf_A_1_F_1 8gwg_A_1_F_1 8gwi_A_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |