#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 761-st Site(D)

PID QueryLength FocusSite TITLE
7876 932 761 D
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
D:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe E (beta-strand) e (exposed) 25.9
3D Complex Information
Predicted Bind Molecules
nucleotide:22 compound:3 metal:9
Templates for 3D complexes
nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] 6xez_A_1_G_1 7rdy_A_1_G_1 7rdz_A_1_G_1 7re1_A_1_G_1 7re2_A_1_F_1 7re3_A_1_H_1 7re3_J_1_O_1 [xxgggccca ] 6xqb_A_1_E_1 [xxxxcaugcuacgcguag ] 6yyt_A_1_E_1 [xxxxxcuacgcgXugxxxx ] 7b3b_A_1_D_1 [xxxxuucuccuaagaagcua ] 7ctt_A_1_E_1 [xxxxxxxxgcgguaguagcaugcuagggagcag ] 7cyq_A_1_E_1 [agauuaaguuau ] 7dfg_C_1_A_1 [xxxxxgacgauguucgacgauguucgacgacaca ] 7dte_A_1_F_1 [gcgguaguagcaugcuagggagcag ] 7eiz_A_1_G_1 8gw1_A_1_E_1 8gwb_A_1_I_1 [xxxxxxxxxxxxxxxxxxxxxxcuacgcagua ] 7ozu_A_1_D_1 [xgcguagcaugcuacgucauucuccuaagaagcug ] 7uo4_A_1_E_1 [xxxguagcaugcuacgucauucuccuaagaagcug ] 7uo7_A_1_D_1 [xxxguagcaugcuacgucauucuccacgcgaagca ] 8sq9_A_1_F_1 [xxxxxxxxxxxxxagcuauuaaaaucacagauu ] 8urb_A_1_E_1 compound [AT9 ] 7ed5_A_1_N_1 [L2B ] 7uob_A_1_N_1 7uoe_A_1_L_1 metal [MG ] 6xqb_A_1_I_1 7bv2_A_1_J_1 7ctt_A_1_I_1 7dfg_C_1_L_1 7dfh_A_1_K_1 7doi_A_1_K_1 7uob_A_1_I_1 7uoe_A_1_I_1 8sq9_A_1_J_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]