#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 408-th Site(Q)

PID QueryLength FocusSite TITLE
7876 932 408 Q
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
Q:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe (coil) e (exposed) 56.6
3D Complex Information
Predicted Bind Molecules
nucleotide:13 compound:1
Templates for 3D complexes
nucleotide [xxxxxxxxxxxxxxxxxxxxxxxugacugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cyq_A_1_F_1 [xxxxxxccccauaacuuaaucucacauagc ] 7ed5_A_1_F_1 [xxxxxxxxxxxxxxxxxucaugcuucgcguggagaaugacguagcaugcuacxxx ] 7uo9_A_1_E_1 8sq9_A_1_G_1 [gguugugauuuuaauagcuu ] 8g6r_A_1_E_1 [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_A_1_J_1 8gwf_A_1_F_1 8gwg_A_1_F_1 8gwi_A_1_F_1 8gwo_A_1_F_1 [ugacugcucccuagcaugcuacuaccg ] 8gwe_A_1_J_1 [xxxxxxxxxxxxxxxugucaugcuucgcguggagaaugacguagcaugcuxxxxx ] 8sqj_A_1_G_1 [ugucaugcuucgcguggagaaugacguagcaugcu ] 8sqk_A_1_G_1 compound [GO3 ] 8gy6_A_1_F_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]