#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 551-st Site(K)

PID QueryLength FocusSite TITLE
7876 932 551 K
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe S (bend) e (exposed) 63.7
3D Complex Information
Predicted Bind Molecules
hetero:1 nucleotide:3 compound:3
Templates for 3D complexes
hetero [17046:R1AB_SARS2 ] 7krp_A_1_C_1 nucleotide [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 compound [H3U ] 7d4f_D_1_H_1 [NWX ] 7uo4_A_1_G_1 [CTP ] 7uoe_A_1_K_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]