Summary for the 498-th Site(L) |
PID | QueryLength | FocusSite | TITLE |
7876 | 932 | 498 L |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
L:41% A:17% K:16% Y:14% N:11% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | (coil) | e (exposed) | 23.0 |
Predicted Bind Molecules |
nucleotide:2 |
Templates for 3D complexes |
nucleotide [xxgggccca ] 6xqb_A_1_E_1 [aagaagcuauuaaaaucaca ] 8g6r_A_1_D_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |