#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 511-st Site(K)
PID QueryLength FocusSite TITLE
7876 932 511 K
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
K:44% T:30% Q:15% V:12%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe (coil) e (exposed) 50.9
3D Complex Information
Predicted Bind Molecules
nucleotide:8
Templates for 3D complexes
nucleotide [xxxxxxugcacugcguagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7b3d_A_1_E_1 7oyg_A_1_E_1 7oyg_F_1_J_1 [xxxxxxxxxxxxxxxxxxxxxxxugacugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cyq_A_1_F_1 [ggXacugcguagxxxxxxxxxxxxxxxxxxxxxxxxx ] 7ozu_A_1_E_1 [xxxxxxxxxxxxxxxxxucaugcuucgcguggagaaugacguagcaugcuacxxx ] 7uo9_A_1_E_1 8sq9_A_1_G_1 [gguugugauuuuaauagcuu ] 8g6r_A_1_E_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]