Summary for the 761-st Site(D) |
PID | QueryLength | FocusSite | TITLE |
7876 | 932 | 761 D |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
D:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwk | E (beta-strand) | e (exposed) | 27.2 |
Predicted Bind Molecules |
nucleotide:21 compound:3 metal:9 |
Templates for 3D complexes |
nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] 6xez_A_1_G_1 7rdy_A_1_G_1 7rdz_A_1_G_1 7re1_A_1_G_1 7re2_A_1_F_1 7re3_A_1_H_1 7re3_J_1_O_1 [xxgggccca ] 6xqb_A_1_E_1 [xxxxcaugcuacgcguag ] 6yyt_A_1_E_1 [xxxxxcuacgcgXugxxxx ] 7b3b_A_1_D_1 [xxxxuucuccuaagaagcua ] 7ctt_A_1_E_1 [xxxxxxxxgcgguaguagcaugcuagggagcag ] 7cyq_A_1_E_1 [agauuaaguuau ] 7dfg_C_1_A_1 [xxxxxgacgauguucgacgauguucgacgacaca ] 7dte_A_1_F_1 [gcgguaguagcaugcuagggagcag ] 7eiz_A_1_G_1 8gw1_A_1_E_1 8gwb_A_1_I_1 [xxxxxxxxxxxxxxxxxxxxxxcuacgcagua ] 7ozu_A_1_D_1 [xgcguagcaugcuacgucauucuccuaagaagcug ] 7uo4_A_1_E_1 [xxxguagcaugcuacgucauucuccuaagaagcug ] 7uo7_A_1_D_1 [xxxguagcaugcuacgucauucuccacgcgaagca ] 8sq9_A_1_F_1 compound [AT9 ] 7ed5_A_1_N_1 [L2B ] 7uob_A_1_N_1 7uoe_A_1_L_1 metal [MG ] 6xqb_A_1_I_1 7bv2_A_1_J_1 7ctt_A_1_I_1 7dfg_C_1_L_1 7dfh_A_1_K_1 7doi_A_1_K_1 7uob_A_1_I_1 7uoe_A_1_I_1 8sq9_A_1_J_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |