Summary for the 623-rd Site(D) |
PID | QueryLength | FocusSite | TITLE |
7876 | 932 | 623 D |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
D:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwk | H (alpha-helix) | e (exposed) | 37.0 |
Predicted Bind Molecules |
nucleotide:6 compound:15 precipitant:1 |
Templates for 3D complexes |
nucleotide [xxxxccuacgcXgugxxxx ] 7b3c_A_1_D_1 [xxxxxxacgacacaggXgxxxx ] 7c2k_A_1_F_1 [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 [cuaagaagcuauuXXXXxxxxxxxxxxxxxxxx ] 7l1f_A_1_D_1 compound [GE6 ] 7aap_A_1_M_1 7ctt_A_1_J_1 [F86 ] 7bv2_A_1_K_1 [1RP ] 7dfg_C_1_G_1 [RVP ] 7dfh_A_1_N_1 [HCU ] 7doi_A_1_O_1 7dok_C_1_G_1 [AT9 ] 7ed5_A_1_K_1 [NWX ] 7uo4_A_1_G_1 [ATP ] 7uo7_A_1_G_1 [UTP ] 7uo9_A_1_J_1 [GTP ] 7uob_A_1_L_1 [CTP ] 7uoe_A_1_K_1 [WSB ] 8sq9_A_1_L_1 [VSN ] 8sqk_A_1_I_1 precipitant [POP ] 7bv2_A_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |