Summary for the 550-th Site(A) |
PID | QueryLength | FocusSite | TITLE |
7876 | 932 | 550 A |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
A:44% G:33% K:12% S:11% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwk | S (bend) | e (exposed) | 44.6 |
Predicted Bind Molecules |
hetero:6 nucleotide:3 compound:1 |
Templates for 3D complexes |
hetero [17077:R1AB_CVHSA ] 6nur_A_1_C_1 6yyt_A_1_C_1 7btf_A_1_B_1 7dfh_A_1_C_1 7krp_A_1_C_1 7uoe_A_1_C_1 nucleotide [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 compound [H3U ] 7d4f_D_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |