|
PID | QueryLength | FocusSite | TITLE |
7876 | 932 | 857 E |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
E:72% L:3% A:2% R:2% D:2% G:2% I:2% K:2% P:2% S:2% T:2% V:2% N:1% C:1% Q:1% H:1% M:1% F:1% Y:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
H (alpha-helix) | e (exposed) | 60.8 |
Predicted Bind Molecules |
nucleotide:55 compound:1 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxxxxxaauagcuucuuaggagaaugacguagcaugcuacgcx ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |