#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 815-th Site(Q)

PID QueryLength FocusSite TITLE
7876 932 815 Q
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
Q:60% A:23% S:16% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwk B (beta-bridge) b (buried) 14.8
3D Complex Information
Predicted Bind Molecules
nucleotide:27
Templates for 3D complexes
nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] 6xez_A_1_G_1 7rdx_A_1_G_1 7re2_A_1_F_1 7re3_A_1_H_1 7re3_J_1_O_1 [xxxxxxxxxxxxxxxuuaaguuau ] 7aap_A_1_E_1 [xxxxxcuacgcgXugxxxx ] 7b3b_A_1_D_1 [xxxxxxxxxgauuaaguuau ] 7bv2_A_1_D_1 [xxxxxgacgacaca ] 7bzf_A_1_F_1 [xxxxuucuccuaagaagcua ] 7ctt_A_1_E_1 [gcgguaguagcaugcuagggagcag ] 7cxn_A_1_E_1 8gw1_A_1_E_1 8gwb_A_1_I_1 8gwe_A_1_I_1 8gwf_A_1_E_1 8gwg_A_1_E_1 8gwi_A_1_E_1 [xxxxxxxxgcgguaguagcaugcuagggagcag ] 7cyq_A_1_E_1 [agauuaaguuau ] 7doi_A_1_D_1 [gcuaugugagauuaaguuau ] 7dok_C_1_A_1 7ed5_A_1_E_1 [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 [xgcguagcaugcuacgucauucuccuaagaagcug ] 7uo4_A_1_E_1 [xxxguagcaugcuacgucauucuccuaagaagcug ] 7uo7_A_1_D_1 [xxcguagcaugcuacgucauucuccacgcgaagca ] 7uoe_A_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]