|
PID | QueryLength | FocusSite | TITLE |
7876 | 932 | 590 G |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
G:91% A:1% D:1% E:1% L:1% K:1% P:1% S:1% T:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
T (Hbond turn) | e (exposed) | 54.8 |
Predicted Bind Molecules |
nucleotide:57 compound:1 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxxxxxaauagcuucuuaggagaaugacguagcaugcuacgcx ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |