Summary for the 560-th Site(V) |
PID | QueryLength | FocusSite | TITLE |
7876 | 932 | 560 V |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
V:38% T:26% C:13% I:13% S:10% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwf | (coil) | b (buried) | 10.0 |
Predicted Bind Molecules |
nucleotide:10 |
Templates for 3D complexes |
nucleotide [xxxxxxxuuuauaacuuaaucxxxxxxxxx ] 7bv2_A_1_E_1 [xxxxxxxxxxxxxxxxxxacuagcuucuuaggagaaxxxx ] 7ctt_A_1_F_1 [cccuauaacuuaaucu ] 7dfg_C_1_B_1 [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_A_1_T_1 7egq_I_1_V_1 [xxxxxxxxaugugauuuuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdx_A_1_H_1 [xxxxxxxxxxxxxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7re3_A_1_I_1 7re3_J_1_P_1 [xxxxxxxxxxxxxxxxxxcucagcuucuuaggagaaugacguagcaugcuacgcx ] 7uo4_A_1_F_1 [xxxxxxxxxxxxxxxxxxcucagcuucuuaggagaaugacguagcaugcuacxxx ] 7uo7_A_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |