|
PID | QueryLength | FocusSite | TITLE |
7876 | 932 | 513 R |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
R:33% D:16% K:13% T:13% G:10% S:4% L:2% A:1% N:1% Q:1% E:1% I:1% F:1% P:1% Y:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
H (alpha-helix) | e (exposed) | 44.7 |
Predicted Bind Molecules |
nucleotide:32 |
Templates for 3D complexes |
nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |