#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 550-th Site(A)

PID QueryLength FocusSite TITLE
7876 932 550 A
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
A:39% G:29% K:23% S:10% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwf S (bend) e (exposed) 52.7
3D Complex Information
Predicted Bind Molecules
hetero:6 nucleotide:3 compound:1
Templates for 3D complexes
hetero [17482:R1AB_CVHSA ] 6nur_A_1_C_1 6yyt_A_1_C_1 7btf_A_1_B_1 7dfh_A_1_C_1 7krp_A_1_C_1 7uoe_A_1_C_1 nucleotide [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 compound [H3U ] 7d4f_D_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]