#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 549-th Site(S)

PID QueryLength FocusSite TITLE
7876 932 549 S
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
S:64% C:26% Q:10% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwf B (beta-bridge) b (buried) 16.4
3D Complex Information
Predicted Bind Molecules
nucleotide:2 compound:1
Templates for 3D complexes
nucleotide [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 compound [H3U ] 7d4f_D_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]