Summary for the 32-nd Site(E) |
PID | QueryLength | FocusSite | TITLE |
6678 | 198 | 32 E |
AC/ID | AC:YP_009725304.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
P:44% Q:31% E:11% A:8% S:6% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | H (alpha-helix) | e (exposed) | 37.2 |
Predicted Bind Molecules |
nucleotide:1 |
Templates for 3D complexes |
nucleotide [xxxxxgacgauguucgacgauguucgacgacaca ] 7dte_B_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |