Summary for the 2-nd Site(E) |
PID | QueryLength | FocusSite | TITLE |
4636 | 527 | 2 E |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
E:53% Q:33% S:15% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | (coil) | e (exposed) | 64.8 |
Predicted Bind Molecules |
hetero:3 nucleotide:4 |
Templates for 3D complexes |
hetero [30940:Q1T6X8_CVHSA ] 5nfy_B_1_F_1 7n0d_B_1_A_1 7n0d_I_1_H_1 nucleotide [xxxxxxxxxxxxxxagaagcuauuaaaaucacc ] 7n0b_B_1_D_1 [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] 7n0c_B_1_D_1 [xxxxxxxxcuauuaaaaucacc ] 7n0d_B_1_F_1 7n0d_I_1_M_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |