Summary for the 103-rd Site(T) |
PID | QueryLength | FocusSite | TITLE |
4636 | 527 | 103 T |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
T:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | (coil) | b (buried) | 4.5 |
Predicted Bind Molecules |
hetero:2 nucleotide:5 compound:3 precipitant:1 |
Templates for 3D complexes |
hetero [28250:R1AB_SARS2 ] 7egq_H_1_F_1 7egq_P_1_N_1 nucleotide [xxxaugugauuuuaauagcuucuuaggaxxxxxxxxx ] 7n0c_B_1_C_1 [ggggaugugauuuuaauagxxxxxxxx ] 7n0d_B_1_E_1 7n0d_D_1_E_1 7n0d_I_1_L_1 7n0d_K_1_L_1 compound [LJA ] 5slf_A_1_H_1 [UX1 ] 5slu_A_1_H_1 [K1S ] 5smf_A_1_G_1 precipitant [EDO ] 7mc5_A_1_K_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |