Summary for the 39-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
348941 | 198 | 39 K |
AC/ID | AC:YP_009725304.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:31% R:26% Q:16% E:16% T:11% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7uo9 | H (alpha-helix) | b (buried) | 15.6 |
Predicted Bind Molecules |
homo:2 nucleotide:9 |
Templates for 3D complexes |
homo [29213:R1AB_CVHSA ] 2ahm_E_1_H_1 2ahm_E_2_H_2 nucleotide [xxxxxxxxxxxxxxxxxxxxxxxagcugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cxm_D_1_F_1 [xxxxxxxxxxxxxxxxxxxxxxxugacugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cyq_D_1_F_1 [xxxxxxxxxxxxxxxxxxxcuccugugucgucgaacaucgucgaacaucgucxxxxx ] 7dte_B_1_E_1 [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_D_1_T_1 [agcugcucccuagcaugcuacuaccg ] 8gw1_D_1_F_1 [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_B_1_J_1 8gwb_D_1_J_1 8gwn_B_1_F_1 8gwo_B_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |