Summary for the 58-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
348941 | 198 | 58 K |
AC/ID | AC:YP_009725304.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7uo9 | H (alpha-helix) | e (exposed) | 62.3 |
Predicted Bind Molecules |
hetero:21 homo:4 nucleotide:13 |
Templates for 3D complexes |
hetero [96648:R1AB_SARS2 ] 7cxm_B_1_H_1 7cxn_B_1_H_1 7cyq_D_1_G_1 7egq_B_1_Q_1 7egq_J_1_R_1 7eiz_B_1_J_1 7eiz_D_1_K_1 7kro_B_1_F_1 7rdz_B_1_F_1 7re0_D_1_E_1 7re1_B_1_F_1 7re3_G_1_N_1 8gw1_B_1_H_1 8gw1_D_1_G_1 8gwe_D_1_F_1 8gwf_D_1_G_1 8gwg_D_1_G_1 8gwi_D_1_G_1 8gwk_B_1_H_1 8gwn_D_1_G_1 8gwo_D_1_G_1 homo [29213:R1AB_CVHSA ] 2ahm_G_1_E_1 2ahm_G_2_E_2 2ahm_H_1_F_1 2ahm_H_2_F_2 nucleotide [xxxxxxxxxxxxxxxxxxxxxxxugacugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cyq_D_1_F_1 [gcuaugugagauuaaguuau ] 7ed5_D_1_E_1 [gcgguaguagcaugcuagggagcag ] 7egq_D_1_S_1 7egq_L_1_U_1 8gwk_D_1_E_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_B_1_H_1 [xxxxxxxxxxxxxxxxxxcucagcuucuuaggagaaugacguagcaugcuacgcx ] 7uo4_D_1_F_1 [xxxxxxxxxxxxxxxxxxcucagcuucuuaggagaaugacguagcaugcuacxxx ] 7uo7_B_1_E_1 [xxxxxxxxxxxxxxxxxucaugcuucgcguggagaaugacguagcaugcuacgxx ] 7uob_D_1_F_1 [agcugcucccuagcaugcuacuaccg ] 8gw1_D_1_F_1 [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_B_1_J_1 [ucuccuaagaagcuauuaaaaucacagauu ] 9cpo_B_1_E_1 [aaaaaucugugauuuuaauagcuucuuaggaga ] 9cpo_D_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |