#WARNING:no index is registered index "YP_009725304.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725304.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 37-th Site(K)

PID QueryLength FocusSite TITLE
348941 198 37 K
UniProt Information
AC/IDAC:YP_009725304.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
Q:51% A:38% K:11% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe H (alpha-helix) e (exposed) 28.3
3D Complex Information
Predicted Bind Molecules
homo:1 nucleotide:1
Templates for 3D complexes
homo [48094:U6BRU0_9ALPC ] 8urb_D_1_B_1 nucleotide [xxxxxgacgauguucgacgauguucgacgacaca ] 7dte_B_1_F_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]