Summary for the 55-th Site(M) |
PID | QueryLength | FocusSite | TITLE |
348941 | 198 | 55 M |
AC/ID | AC:YP_009725304.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
V:70% T:19% M:11% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | H (alpha-helix) | e (exposed) | 56.0 |
Predicted Bind Molecules |
hetero:7 homo:4 nucleotide:1 |
Templates for 3D complexes |
hetero [94973:R1AB_SARS2 ] 7egq_B_1_Q_1 7eiz_B_1_J_1 7rdx_B_1_F_1 7rdy_B_1_F_1 7rdz_B_1_F_1 8gwb_B_1_F_1 8gwb_D_1_E_1 homo [28576:R1AB_CVHSA ] 2ahm_G_1_E_1 2ahm_G_2_E_2 2ahm_H_1_F_1 2ahm_H_2_F_2 nucleotide [gcgguaguagcaugcuagggagcag ] 8gw1_B_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |