Summary for the 856-th Site(F)

PID QueryLength FocusSite TITLE
2752856 925 856 F RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 856-th site STRAND:
DOMAIN: /note="RLR CTR"
REGION: /note="Mediates interaction with RNF135"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
W:31% Y:29% F:26% I:14% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7to0 (coil) b (buried) 1.4
3D Complex Information
Predicted Bind Molecules
nucleotide:4
Templates for 3D complexes
nucleotide [gcgcgcgcgc ] 2ykg_A_1_B_1 4bpb_A_1_B_1 [atctcXgXgXcaXgXgXXXXaaXgXcagXXXaaXgaXgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7mk1_B_1_D_1 [Xgacguacguuucgcgacuguagaxxxx ] 8g7u_C_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]