Summary for the 723-rd Site(K) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 723 K | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 723-th site |
HELIX: DOMAIN: /note="Helicase C-terminal" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
S:36% R:17% Q:13% H:10% K:10% A:6% D:4% M:4% G:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7to0 | H (alpha-helix) | e (exposed) | 25.5 |
Predicted Bind Molecules |
homo:1 nucleotide:10 metal:3 precipitant:2 |
Templates for 3D complexes |
homo [96250:DDX58_HUMAN ] 4on9_A_1_B_1 nucleotide [cgacgcuagcguxx ] 5e3h_A_1_B_1 [cgacgcuagcgucx ] 6gpg_C_1_A_1 [gacugacugacuga ] 7jl1_A_1_B_1 [gacugacugacugagacugacugacugagacugacugacuga ] 7jl3_A_1_G_1 7jl3_C_1_G_1 7jl3_E_1_G_1 [Xgacguacguuuxxxxxxxxxxxxxxxx ] 7tnx_A_1_B_1 [Xgacguacgucgxxxxxxxxxxxxxxxx ] 7tny_A_1_B_1 [ggacguacgucgxxxxxxxxxxxx ] 7to0_A_1_B_1 [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1 metal [MG ] 5f9f_A_1_N_1 5f9f_I_1_JA_1 5f9f_K_1_MA_1 precipitant [BU3 ] 5f9f_E_1_AA_1 5f9f_G_1_FA_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |