Summary for the 500-th Site(Q) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 500 Q | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 500-th site |
REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
Q:20% G:12% S:11% A:10% R:9% E:9% L:9% H:6% N:4% M:2% D:1% I:1% K:1% F:1% P:1% T:1% Y:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7to0 | S (bend) | e (exposed) | 97.4 |
Predicted Bind Molecules |
homo:4 nucleotide:11 |
Templates for 3D complexes |
homo [96250:DDX58_HUMAN ] 4on9_A_1_B_1 8g7t_A_1_C_1 8g7t_C_1_A_1 8g7u_C_1_A_1 nucleotide [gguagacgcuucggcguuugcc ] 6kyv_B_1_A_1 6kyv_D_1_C_1 6kyv_F_1_E_1 6kyv_H_1_G_1 6kyv_J_1_I_1 [Xgacguacguuuxxxxxxxxxxxxxxxx ] 7tnx_A_1_B_1 [Xgacguacgucgxxxxxxxxxxxxxxxx ] 7tnz_A_1_B_1 [ggacguacgucgxxxxxxxxxxxx ] 7to0_A_1_B_1 [Xgaucgaucgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxucgaucgauccxxxx ] 7to1_A_1_B_1 [Xgacguacguuucgcgacuguagaxxxx ] 8g7t_A_1_E_1 8g7u_A_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |