Summary for the 500-th Site(Q)

PID QueryLength FocusSite TITLE
2752856 925 500 Q RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 500-th site REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
Q:20% G:12% S:11% A:10% R:9% E:9% L:9% H:6% N:4% M:2% D:1% I:1% K:1% F:1% P:1% T:1% Y:1% V:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7to0 S (bend) e (exposed) 97.4
3D Complex Information
Predicted Bind Molecules
homo:4 nucleotide:11
Templates for 3D complexes
homo [96250:DDX58_HUMAN ] 4on9_A_1_B_1 8g7t_A_1_C_1 8g7t_C_1_A_1 8g7u_C_1_A_1 nucleotide [gguagacgcuucggcguuugcc ] 6kyv_B_1_A_1 6kyv_D_1_C_1 6kyv_F_1_E_1 6kyv_H_1_G_1 6kyv_J_1_I_1 [Xgacguacguuuxxxxxxxxxxxxxxxx ] 7tnx_A_1_B_1 [Xgacguacgucgxxxxxxxxxxxxxxxx ] 7tnz_A_1_B_1 [ggacguacgucgxxxxxxxxxxxx ] 7to0_A_1_B_1 [Xgaucgaucgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxucgaucgauccxxxx ] 7to1_A_1_B_1 [Xgacguacguuucgcgacuguagaxxxx ] 8g7t_A_1_E_1 8g7u_A_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]