Summary for the 418-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 418 K | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 418-th site |
DOMAIN: /note="Helicase ATP-binding" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:25% S:18% R:11% D:11% E:10% T:6% G:4% L:3% V:3% Q:2% A:1% N:1% I:1% F:1% P:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7to0 | (coil) | e (exposed) | 68.9 |
Predicted Bind Molecules |
homo:12 nucleotide:5 |
Templates for 3D complexes |
homo [96250:DDX58_HUMAN ] 5f98_A_1_E_1 5f98_E_1_A_1 5f9f_A_1_E_1 5f9f_E_1_A_1 5f9h_A_1_E_1 5f9h_E_1_A_1 7jl3_A_1_E_1 7jl3_C_1_A_1 8g7t_A_1_C_1 8g7t_C_1_A_1 8g7u_A_1_C_1 8g7v_A_1_C_1 nucleotide [ggaucgaucgaucxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgaucgaucgaucc ] 8dvs_A_1_B_1 [xxxxxgaucgaucgaucggcaucxxxxxxxxxxxxxxxxxxgaugccgaucgaucgaucxxxxx ] 8dvu_A_1_B_1 [Xcuacagucgcgaaacguacguccxxxx ] 8g7t_A_1_F_1 [Xgacguacguuucgcgacuguagaxxxx ] 8g7t_C_1_E_1 [Xgaucgaucgaucgaucggcaucgaucggcxxxxgccgaucgaugccgaucgaucgaucgauccxxxx ] 8scz_A_1_B_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |