Summary for the 416-th Site(D)
PID QueryLength FocusSite TITLE
2752856 925 416 D RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 416-th site DOMAIN: /note="Helicase ATP-binding"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
D:28% K:16% G:13% S:8% A:5% T:5% E:4% I:4% P:4% V:4% R:3% H:2% L:2% N:1% Q:1% F:1% Y:1%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs S (bend) e (exposed) 77.8
3D Complex Information
Predicted Bind Molecules
homo:1 nucleotide:1
Templates for 3D complexes
homo [94569:DDX58_HUMAN ] 8g7v_A_1_C_1 nucleotide [Xgaucgaucgaucgaucggcaucgaucggcxxxxgccgaucgaugccgaucgaucgaucgauccxxxx ] 8scz_A_1_B_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]