|
|
| PID | QueryLength | FocusSite | TITLE |
| 2752856 | 925 | 376 N | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
| AC/ID | AC:O95786 ID:RIGI_HUMAN |
| Feature Table for 376-th site |
HELIX: DOMAIN: /note="Helicase ATP-binding" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins
 [show alignment]
|
H:51% R:21% N:10% L:7% D:4% K:4% S:4% |
| Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
 8dvs |
G (3/10-helix) | b (buried) | 14.5 |
| Predicted Bind Molecules |
| nucleotide:3 metal:1 precipitant:1 |
| Templates for 3D complexes |
|
nucleotide [gaauauaauagugauauuauauuc ] 5f9f_K_1_L_1 [gguagacgcuucggcguuugcc ] 6kyv_L_1_K_1 [Xgacguacguuucgcgacuguagxxxxx ] 8g7v_C_1_E_1
metal [MG ] 5f9h_E_1_U_1
precipitant [BU3 ] 5f9f_C_1_V_1
|
 [Back to SiteTable] |
 [Back to Search Page] |
 [Back to Top Page] |
Summary for the 376-th Site(N)