Summary for the 330-th Site(E)
PID QueryLength FocusSite TITLE
2752856 925 330 E RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I;
UniProt Information
AC/IDAC:O95786 ID:RIGI_HUMAN
Feature Table for 330-th site STRAND:
DOMAIN: /note="Helicase ATP-binding"
REGION: /note="Interaction with ZC3HAV1"
CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
E:22% D:16% S:10% P:8% Q:7% W:6% T:5% V:5% R:4% L:4% Y:4% K:3% G:2% A:1% N:1%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8dvs S (bend) e (exposed) 53.8
3D Complex Information
Predicted Bind Molecules
homo:1 nucleotide:10 precipitant:1
Templates for 3D complexes
homo [94569:DDX58_HUMAN ] 8g7v_C_1_A_1 nucleotide [gaauauaauagugauauuauauuc ] 5f98_C_1_D_1 5f98_G_1_H_1 5f9f_A_1_B_1 5f9f_K_1_L_1 [aauauaauagugauauuauauuc ] 5f9h_C_1_D_1 5f9h_K_1_L_1 [gguagacgcuucggcguuugcc ] 6kyv_B_1_A_1 [xxxxxgaucgaucgaucggcxxxxxxxxxxxxxxxxxxxxxxxxgccgaucgaucgaucxxxxxxxxx ] 7to2_A_1_B_1 [xxxxxgaucgaucgaucggcaucxxxxxxxxxxxxxxxxxxgaugccgaucgaucgaucxxxxx ] 8dvu_A_1_B_1 [xcuacagucgcgaaacguacguccxxxx ] 8g7v_C_1_F_1 precipitant [BU3 ] 5f9f_G_1_EA_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]