|
PID | QueryLength | FocusSite | TITLE |
2752856 | 925 | 667 T | RecName: Full=Antiviral innate immune response receptor RIG-I ;AltName: Full=ATP-dependent RNA helicase DDX58 ; EC=3.6.4.13 ;AltName: Full=DEAD box protein 58;AltName: Full=RIG-I-like receptor 1; Short=RLR-1;AltName: Full=RNA sensor RIG-I ;AltName: Full=Retinoic acid-inducible gene 1 protein; Short=RIG-1;AltName: Full=Retinoic acid-inducible gene I protein; Short=RIG-I; |
AC/ID | AC:O95786 ID:RIGI_HUMAN |
Feature Table for 667-th site |
STRAND: DOMAIN: /note="Helicase C-terminal" REGION: /note="Interaction with ZC3HAV1" CHAIN: /note="Antiviral innate immune response receptor RIG-I" /id="PRO_0000144093" |
Percentages of Amino Acids in Homologous Proteins
![]() |
S:20% T:19% G:12% A:10% E:8% K:7% R:4% N:4% I:4% M:4% D:3% C:2% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
T (Hbond turn) | e (exposed) | 47.4 |
Predicted Bind Molecules |
nucleotide:18 precipitant:1 |
Templates for 3D complexes |
nucleotide [gaauauaauagugauauuauauuc ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |